Order Kazusa clone(s) from : ![]() |
Product ID | ORK01180 |
---|---|
Accession No | AB058691 |
Description | ALX homeobox 4 |
Clone name | fh22801 |
Vector information | |
cDNA sequence | DNA sequence (5654 bp) Predicted protein sequence (413 aa) |
Flexi ORF Clone | FXC01180 |
Source | Human fetal brain |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 4411 bp |
---|---|
Genome contig ID | gi51511727r_44138570 |
PolyA signal sequence (AATAAA,-23) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 11 | r | 44238570 | 44288195 | 4 | 99.1 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR001356 | 216 | 273 | PD000010 | Homeobox |
FPrintScan | IPR001356 | 253 | 263 | PR00024 | Homeobox |
IPR001356 | 263 | 272 | PR00024 | Homeobox | |
HMMPfam | IPR001356 | 217 | 273 | PF00046 | Homeobox |
IPR003654 | 388 | 408 | PF03826 | Paired-like homeodomain protein | |
HMMSmart | IPR001356 | 216 | 278 | SM00389 | Homeobox |
ProfileScan | IPR001356 | 214 | 274 | PS50071 | Homeobox |
IPR003654 | 393 | 406 | PS50803 | Paired-like homeodomain protein | |
ScanRegExp | IPR001356 | 249 | 272 | PS00027 | Homeobox |
![]() |
Primer_f | AATAGCACTTGGAGGACATGG |
---|---|
Primer_r | CGCAGTGTCTTTGAGCTAACC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | CCR |
---|---|
Primer_f | AATAGCACTTGGAGGACATGG |
Primer_r | CGCAGTGTCTTTGAGCTAACC |
PCR product length | 131 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |