KIAA1454

Gene/Protein Characteristic Table for KIAA1454

Order Kazusa clone(s) from :

Product ID	ORK06732
Accession No	AB040887
Description	S-phase cyclin A-associated protein in the ER
Clone name	fh15916
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5438 bp) Predicted protein sequence (1265 aa)
Source	Human fetal brain
Rouge ID	mKIAA1454 by Kazusa Mouse cDNA Project

Length: 5438 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1639 bp
Genome contig ID	gi51511731r_74359119
PolyA signal sequence (ATTAAA,-17)	+--------+--------+----*----+---- ATAATGTCAAGTGATTTCATTAAAAAAGGAAAAAG
Flanking genome sequence (99986 - 99937)	----+--------+--------+--------+--------+----* AAAAAAAAAAGGAAAAGAAAAAAATCAAAAAGAAAAATCAAAAGCCTATT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	15	r	74459105	74984799	27	99.6	Perfect prediction

Features of the protein sequence

Description

Length: 1265 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_001147278	99.1	zinc finger pro...	Pan troglodytes
BAG10459	99.2	zinc finger pro...	synthetic construct
Q9BY12	99.1	S phase cyclin ...	Homo sapiens
EAW99218	99.1	zinc finger pro...	Homo sapiens
XP_523229	98.6	zinc finger pro...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMSmart	IPR003604	810	844	SM00451	Zinc finger
ScanRegExp	IPR007087	815	837	PS00028	Zinc finger

Expression profile

Description

RT-PCR-ELISA

Experimental conditions

Primer_f	CTAGGATAAGTCAGCTGTTCG
Primer_r	TGGTGCGCCTTTGTGAGTGAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information

Description

Chromosome No. 15

Experimental conditions

Panel name	GeneBridge 4
Primer_f	CTAGGATAAGTCAGCTGTTCG
Primer_r	TGGTGCGCCTTTGTGAGTGAG
PCR product length	118 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp