Order Kazusa clone(s) from : ![]() |
Product ID | ORK01686 |
---|---|
Accession No | AB037736 |
Description | caspase 8 associated protein 2 |
Clone name | fh12764s1 |
Vector information | |
cDNA sequence | DNA sequence (6834 bp) Predicted protein sequence (1981 aa) |
HaloTag ORF Clone |
FHC01686
![]() |
Flexi ORF Clone | FXC01686 |
Source | Human fetal brain |
Rouge ID |
mKIAA1315
by Kazusa Mouse cDNA Project
|
Note | We replaced fh12764, former representative clones for KIAA1315 with fh12764s1. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 888 bp |
---|---|
Genome contig ID | gi89161210f_90513030 |
PolyA signal sequence (AATAAA,-20) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (127841 - 127890) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 6 | f | 90613030 | 90640869 | 9 | 99.2 | Internal No-hit |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
Primer_f | TGAGAGACATCCAGTTGAGTT |
---|---|
Primer_r | GCAATATCAGTTAAGAGTCCC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |