| 
Order Kazusa clone(s) from :  | 
| Product ID | ORK01982 | 
|---|---|
| Accession No | AB011172 | 
| Description | histone deacetylase 5 | 
| Clone name | fh08981 | 
| Vector information | |
| cDNA sequence | DNA sequence (5040 bp) Predicted protein sequence (1080 aa)  | 
| 
    
     
    HaloTag ORF Clone  | 
    
    
    
     
    FHC01982
     
     
     | 
| Flexi ORF Clone | FXC01982 | 
| Source | Human fetal brain | 
| Rouge ID | 
    mKIAA0600
    
    by Kazusa Mouse cDNA Project
     | 
| Note | We replaced hg00785a, former representative clones for KIAA0600 with fh08981. (2002/5/10) | 
 Length: 5040 bp
 Physical map
    
 Restriction map
 Prediction of protein coding region (GeneMark analysis).
    | N-terminal truncation | Coding interruption | |
|---|---|---|
| cloned DNA seq | No warning | No warning | 
 Integrity of 3' end
    | Length of 3'UTR | 1622 bp | 
|---|---|
| Genome contig ID | gi51511734r_39409648 | 
| PolyA signal sequence (AATAAA,-23)  | 
            +----*----+----*----+----*----+----  | 
        
| Flanking genome sequence (100000 - 99951)  | 
            ----+----*----+----*----+----*----+----*----+----*  | 
        
  
 Ensembl ContigView  (Add our DAS server as a DAS source)
  
| Chr | f/r | start | end | exon | identity | class | |
|---|---|---|---|---|---|---|---|
| 
 | 17 | r | 39509648 | 39556512 | 25 | 99.7 | Perfect prediction | 
 
        Length: 1080 aa
        Result of homology search against nr database 
        (FASTA output,
	Multiple alignment)![]()  | 
        
        
  | 
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
        Result of homology search against HUGE database
        (FASTA output,
	Multiple alignment)![]()  | 
        
        
  | 
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
	Result of motif / domain search (InterProScan and SOSUI)
 Result of InterProScan
| Search method | interpro_ID | From | To | Entry | Definition | 
|---|---|---|---|---|---|
| FPrintScan | IPR000286 | 787 | 810 | PR01270 | Histone deacetylase superfamily | 
| IPR000286 | 821 | 836 | PR01270 | Histone deacetylase superfamily | |
| IPR000286 | 912 | 922 | PR01270 | Histone deacetylase superfamily | |
| HMMPfam | IPR000286 | 642 | 986 | PF00850 | Histone deacetylase superfamily | 
           
	  RT-PCR
	   | 
	  
	  
|---|
           
	  RT-PCR-ELISA
	   | 
          
	  
 Experimental conditions| Primer_f | TCTCGGCTCTGCTCAGTGTAG | 
|---|---|
| Primer_r | TTTGCTCTGGATCTCGATGAC | 
| PCR conditions | 95 °C 30 sec 55 °C 30 sec 72 °C 60 sec 30 cycles![]()  | 
 Chromosome No. 17
 Experimental conditions| Panel name | GeneBridge 4 | 
|---|---|
| Primer_f | TGCACTCTGAATACCACACCC | 
| Primer_r | CCACAAGGCAGCACAGCATAC | 
| PCR product length | 118 (1.0k) bp | 
| PCR conditions | 95 °C 15 sec 66 °C 60 sec 30 cycles |