Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK05398 |
---|---|
Accession No | AB028961 |
Description | HBS1-like translational GTPase |
Clone name | fh02273 |
Vector information | |
cDNA sequence | DNA sequence (5662 bp) Predicted protein sequence (496 aa) |
Source | Human fetal brain |
Rouge ID |
mKIAA1038
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 4171 bp |
---|---|
Genome contig ID | gi89161210r_135223941 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 6 | r | 135323941 | 135360462 | 13 | 99.3 | Perfect prediction |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR000795 | 74 | 87 | PR00315 | Protein synthesis factor |
IPR000795 | 133 | 141 | PR00315 | Protein synthesis factor | |
IPR000795 | 153 | 163 | PR00315 | Protein synthesis factor | |
IPR000795 | 169 | 180 | PR00315 | Protein synthesis factor | |
IPR000795 | 213 | 222 | PR00315 | Protein synthesis factor | |
HMMPfam | IPR000795 | 70 | 293 | PF00009 | Protein synthesis factor |
IPR004161 | 314 | 381 | PF03144 | Translation elongation factor EFTu/EF1A | |
IPR004160 | 387 | 495 | PF03143 | Translation elongation factor EFTu/EF1A |
RT-PCR-ELISA |
Primer_f | ATCCACTGTGTAAGAAGACTG |
---|---|
Primer_r | GGTAGGAAATCAGAGCATAAC |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | UniGene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |