KIAA0541

Product ID	ORK00094
Accession No	AB011113
Description	WD repeat domain 7, transcript variant 1
Clone name	fg05763
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (7234 bp) Predicted protein sequence (1500 aa)
HaloTag ORF Clone	FHC00094
Flexi ORF Clone	FXC00094
Source	Human fetal brain
Rouge ID	mKIAA0541 by Kazusa Mouse cDNA Project
Note	We replaced hg04294, former representative clones for KIAA0541 with fg05763. (2005/08/06)

Length: 7234 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	2587 bp
Genome contig ID	gi51511735f_52369651
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- TGTACATATGTGTGTTAAATAAAACAATTGTATTG
Flanking genome sequence (478370 - 478419)	----+--------+--------+--------+--------+----* AAGACTGTTTTTCTCACAATATTACCTTTTCCAGTGTTCACTCATCTTAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	18	f	52469651	52848019	28	99.6	Perfect prediction

Length: 1500 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9Y4E6	100.0	WD repeat-conta...	Homo sapiens
XP_523934	99.5	rabconnectin-3 ...	Pan troglodytes
XP_001084761	99.3	similar to rabc...	Macaca mulatta
XP_001488140	97.4	WD repeat domai...	Equus caballus
XP_533395	97.0	similar to WD r...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001680	44	58	PR00320	WD40 repeat
	IPR001680	495	509	PR00320	WD40 repeat
	IPR001680	585	599	PR00320	WD40 repeat
HMMPfam	IPR001680	19	57	PF00400	WD40 repeat
	IPR001680	64	105	PF00400	WD40 repeat
	IPR001680	464	508	PF00400	WD40 repeat
	IPR001680	560	598	PF00400	WD40 repeat
	IPR001680	1394	1421	PF00400	WD40 repeat
HMMSmart	IPR001680	15	57	SM00320	WD40 repeat
	IPR001680	63	105	SM00320	WD40 repeat
	IPR001680	218	252	SM00320	WD40 repeat
	IPR001680	463	508	SM00320	WD40 repeat
	IPR001680	511	556	SM00320	WD40 repeat
	IPR001680	559	598	SM00320	WD40 repeat
	IPR001680	1393	1433	SM00320	WD40 repeat
ProfileScan	IPR001680	25	114	PS50294	WD40 repeat
	IPR001680	32	59	PS50082	WD40 repeat
	IPR001680	470	517	PS50082	WD40 repeat
	IPR001680	470	607	PS50294	WD40 repeat
	IPR001680	566	607	PS50082	WD40 repeat
	IPR001680	1400	1436	PS50082	WD40 repeat
	IPR001680	1400	1442	PS50294	WD40 repeat
ScanRegExp	IPR001680	44	58	PS00678	WD40 repeat
ScanRegExp	IPR001680	495	509	PS00678	WD40 repeat

Primer_f	CCTGTCCTTGTATATGTAGAG
Primer_r	ACATTCAGCACACATAGAGTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	CCTGTCCTTGTATATGTAGAG
Primer_r	ACATTCAGCACACATAGAGTC
PCR product length	188 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles