KIAA1207

Product ID	ORK01681
Accession No	AB033033
Description	myoferlin, transcript variant 1
Clone name	fg04512s1
Vector information	The cDNA fragment was originally inserted at SalI-NotI site ... The cDNA fragment was originally inserted at SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR) and a RT-PCR product (1-2647) was subcloned upstream of the cDNA (2648-6719). The adjacent sequence to the 5' end of the cDNA is as follows: GGGCCCCCCC TCGAGGTCGA CCCACGCGGG CCGCGGGAAT TCGATT-5' end of cDNA.
cDNA sequence	DNA sequence (6719 bp) Predicted protein sequence (2061 aa)
HaloTag ORF Clone	FHC01681
Flexi ORF Clone	FXC01681
Source	Human fetal brain
Rouge ID	mKIAA1207 by Kazusa Mouse cDNA Project
Note	We replaced fg04512, former representative clones for KIAA1207 with fg04512s1. (2002/5/10)

Length: 6719 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	533 bp
Genome contig ID	gi89161187r_94956177
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- TCTGTAATGAAACTAAATAAAAATGTTTCACCTTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACACCTGGCTGTTTGTTGTAACTGTGGGTCAAGTGAGGAAGGAGGCATTT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	10	r	95056177	95231941	53	99.7	Perfect prediction

Length: 2061 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW50074	99.8	fer-1-like 3, m...	Homo sapiens
XP_001089235	99.2	myoferlin [Maca...	Macaca mulatta
XP_858858	94.9	similar to Myof...	Canis lupus fam...
AAF27177	99.5	myoferlin [Homo...	Homo sapiens
XP_878618	93.7	similar to myof...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB018290	0.00019	23.2	KIAA0747

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000008	1570	1582	PR00360	C2 calcium-dependent membrane targeting
	IPR000008	1596	1609	PR00360	C2 calcium-dependent membrane targeting
	IPR000008	1618	1626	PR00360	C2 calcium-dependent membrane targeting
HMMPfam	IPR000008	2	85	PF00168	C2 calcium-dependent membrane targeting
	IPR000008	201	281	PF00168	C2 calcium-dependent membrane targeting
	IPR012968	282	353	PF08151	FerI
	IPR000008	360	458	PF00168	C2 calcium-dependent membrane targeting
	IPR012560	676	741	PF08165	FerA
	IPR012561	768	843	PF08150	FerB
	IPR000008	1141	1231	PF00168	C2 calcium-dependent membrane targeting
	IPR000008	1303	1393	PF00168	C2 calcium-dependent membrane targeting
	IPR000008	1555	1638	PF00168	C2 calcium-dependent membrane targeting
HMMSmart	IPR000008	1	100	SM00239	C2 calcium-dependent membrane targeting
	IPR000008	200	299	SM00239	C2 calcium-dependent membrane targeting
	IPR000008	359	473	SM00239	C2 calcium-dependent membrane targeting
	IPR006613	856	914	SM00693	Dysferlin
	IPR006613	927	983	SM00693	Dysferlin
	IPR006614	992	1030	SM00694	Dysferlin
	IPR006614	1050	1083	SM00694	Dysferlin
	IPR000008	1140	1247	SM00239	C2 calcium-dependent membrane targeting
	IPR000008	1302	1409	SM00239	C2 calcium-dependent membrane targeting
	IPR000008	1554	1653	SM00239	C2 calcium-dependent membrane targeting
	IPR000008	1789	1919	SM00239	C2 calcium-dependent membrane targeting
ProfileScan	IPR000008	1	85	PS50004	C2 calcium-dependent membrane targeting
	IPR000008	200	281	PS50004	C2 calcium-dependent membrane targeting
	IPR000008	359	458	PS50004	C2 calcium-dependent membrane targeting
	IPR000008	1126	1231	PS50004	C2 calcium-dependent membrane targeting
	IPR000008	1538	1638	PS50004	C2 calcium-dependent membrane targeting

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	2026	WVIIGLLFLLILLLFVAVLLYSL	2048	PRIMARY	23

Primer_f	GGACGAACCCAACATGAACCC
Primer_r	GACAAATAGTTCGGCAAAGAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	TTCCCAGACCCCTATGATGAG
Primer_r	TATTTCTCAACAACCAGCAGG
PCR product length	158(1.3k) bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles