KIAA0240

Product ID	ORK01661
Accession No	D87077
Description	GLTSCR1-like
Clone name	fg03390
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6512 bp) Predicted protein sequence (1087 aa)
HaloTag ORF Clone	FHC01661
Flexi ORF Clone	FXC01661
Source	Human fetal brain
Rouge ID	mKIAA0240 by Kazusa Mouse cDNA Project
Note	We replaced ha04715, former representative clones for KIAA0240 with fg03390. (2005/08/06)

Length: 6512 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	2945 bp
Genome contig ID	gi89161210f_42722674
PolyA signal sequence (TATAAA,-15)	+--------+--------+----*----+---- ATACATTTTGTAAAAATATTTATAAAATGTTTTGT
Flanking genome sequence (221434 - 221483)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAACTATAACAAATTGCAGTTTATTTTGTTATGTTGGATA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	6	f	42822674	42944106	15	99.4	Perfect prediction

Length: 1087 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
CAH10475	99.8	hypothetical pr...	Homo sapiens
XP_527387	99.6	hypothetical pr...	Pan troglodytes
XP_532139	94.6	hypothetical pr...	Canis lupus fam...
XP_001362358	83.6	hypothetical pr...	Monodelphis dom...
XP_001509096	78.0	hypothetical pr...	Ornithorhynchus...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Primer_f
Primer_r
PCR conditions	test

Chromosome No. 6

Experimental conditions

Panel name	Genebridge 4
Primer_f	TGTGTCCTTAAGTACTTCCTG
Primer_r	TAAAGCCCACACCACACTGAC
PCR product length	172 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles