Order Kazusa clone(s) from : ![]() |
Product ID | ORK01661 |
---|---|
Accession No | D87077 |
Description | GLTSCR1-like |
Clone name | fg03390 |
Vector information | |
cDNA sequence | DNA sequence (6512 bp) Predicted protein sequence (1087 aa) |
Flexi ORF Clone | FXC01661 |
Source | Human fetal brain |
Rouge ID |
mKIAA0240
by Kazusa Mouse cDNA Project
|
Note | We replaced ha04715, former representative clones for KIAA0240 with fg03390. (2005/08/06) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 2945 bp |
---|---|
Genome contig ID | gi89161210f_42722674 |
PolyA signal sequence (TATAAA,-15) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (221434 - 221483) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 6 | f | 42822674 | 42944106 | 15 | 99.4 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Panel name | Genebridge 4 |
---|---|
Primer_f | TGTGTCCTTAAGTACTTCCTG |
Primer_r | TAAAGCCCACACCACACTGAC |
PCR product length | 172 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |