Order Kazusa clone(s) from : ![]() |
Product ID | ORK05605 |
---|---|
Accession No | AB007936 |
Description | seizure threshold 2 homolog (mouse) |
Clone name | ff08895 |
Vector information | |
cDNA sequence | DNA sequence (10217 bp) Predicted protein sequence (2687 aa) |
Source | Human fetal brain |
Rouge ID |
mKIAA0467
by Kazusa Mouse cDNA Project
|
Note | We replaced hg01512, former representative clones for KIAA0467 with ff08895. (2005/08/06) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | Warning |
Length of 3'UTR | 2153 bp |
---|---|
Genome contig ID | gi89161185f_43561384 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (129509 - 129558) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 1 | f | 43661384 | 43690891 | 57 | 100.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Primer_f | |
---|---|
Primer_r | |
PCR conditions | °C![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | TTTCTCTGCTGCTTCCCTCCC |
Primer_r | GGACATCACTGCTGGACATTC |
PCR product length | 204 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |