KIAA1462

Product ID	ORK01170
Accession No	AB040895
Description	KIAA1462
Clone name	ef00562
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector(Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGC TGAAGCTTTC ACAAGTTTGT ACAAAAAAGC AGGCTCTTC-5' end of cDNA, GAGCTCTCAC CACTTTGTAC AAGAAAGCTG GGCGGCCGCT TTTTTTTTTT TTTTTTT-3' end of cDNA).
cDNA sequence	DNA sequence (7539 bp) Predicted protein sequence (1363 aa)
HaloTag ORF Clone	FHC01170
Flexi ORF Clone	FXC01170
Source
Rouge ID	mKIAA1462 by Kazusa Mouse cDNA Project
Note	We replaced fh18445, former representative clones for KIAA1462 with ef00562. (2001/2/22)

Length: 7539 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	3429 bp
Genome contig ID	gi89161187r_30243390
PolyA signal sequence (ATTAAA,-33)	+--------+--------+----*----+---- CAATTAAATGTCAGGATAGCATCTCTTGCAAAGTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACCAGTGCAGCAGAATTGTCTTTCTATCCATATTTGAGCTTAGAGAAACA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	10	r	30343390	30376777	3	99.0	Perfect prediction

Length: 1363 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_001136276	98.4	hypothetical pr...	Pan troglodytes
XP_001082542	94.3	hypothetical pr...	Macaca mulatta
EAW86017	99.9	hCG1643737, iso...	Homo sapiens
XP_001136194	98.3	hypothetical pr...	Pan troglodytes
CAI46027	99.7	hypothetical pr...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Primer_f	GCCTGTTCTCATCTGTACCGT
Primer_r	CTGCTGTGAAAACTGGAGTGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-