Gene/Protein Characteristic Table for FLJ00085
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK05304
Accession No AK024486
Clone name as00085
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4186 bp)
Predicted protein sequence (292 aa)
Source Human spleen
Rouge ID mFLJ00085 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 4186 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning Warning
Features of the protein sequence
Description

Length: 292 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAB15776 1.7e-101 100.0 FLJ00085 protei...
Homo sapiens
T34536 1.6e-52 81.9 EST70162 Human ...
Homo sapiens
EAW57510 1.3e-35 92.9 glioma tumor su...
Homo sapiens
CAB94787 3.4e-33 77.9 GLTSCR2, glioma...
Homo sapiens
AAH07248 3.4e-33 77.9 glioma tumor su...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against other entries from Kazusa human cDNA project (FASTA output, Multiple alignment)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
ProfileScan NULL 103 224 PS50323 NULL
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f CGAGAACACATCCAAAGTCCC
Primer_r TTGTTGCAGAAGGGTTGAGGA
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the NEDO Protein Database homepage
Send a message to office AT kazusa.or.jp