Order Kazusa clone(s) from : ![]() |
Product ID | ORK05304 |
---|---|
Accession No | AK024486 |
Clone name | as00085 |
Vector information | |
cDNA sequence | DNA sequence (4186 bp) Predicted protein sequence (292 aa) |
Source | Human spleen |
Rouge ID |
mFLJ00085
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | Warning |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
ProfileScan | NULL | 103 | 224 | PS50323 | NULL |
![]() |
Primer_f | CGAGAACACATCCAAAGTCCC |
---|---|
Primer_r | TTGTTGCAGAAGGGTTGAGGA |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |