Gene/Protein Characteristic Table for FLJ00077
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK05063
Accession No AK024483
Clone name as00077
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4534 bp)
Predicted protein sequence (278 aa)
Source Human spleen
Features of the cloned cDNA sequence
Description

Length: 4534 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning Warning
Features of the protein sequence
Description

Length: 278 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAB15773 7.3e-102 100.0 FLJ00077 protei...
Homo sapiens
AAB60391 3.1e-101 99.6 unknown [Homo s...
Homo sapiens
EAW49753 6.1e-69 74.8 F-box and WD-40...
Homo sapiens
XP_001925008 1.6e-59 67.1 similar to F-bo...
Sus scrofa
AAF04527 4.5e-52 100.0 F-box protein F...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against other entries from Kazusa human cDNA project (FASTA output, Multiple alignment)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
ProfileScan NULL 2 121 PS50315 NULL
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f CCATTACTCAGCTCTTTTGTG
Primer_r AGTCCCAGTAGCGAACATAGG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the NEDO Protein Database homepage
Send a message to office AT kazusa.or.jp