Order Kazusa clone(s) from : ![]() |
Product ID | ORK05047 |
---|---|
Accession No | AK024456 |
Clone name | as00048 |
Vector information | |
cDNA sequence | DNA sequence (4314 bp) Predicted protein sequence (146 aa) |
Source | Human spleen |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
Primer_f | ATAATCCAGGGGGTACCACTC |
---|---|
Primer_r | TGGGAACATGCTGAGTAAGAC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |