|
Order Kazusa clone(s) from : |
| Product ID | ORK05039 |
|---|---|
| Accession No | AK024436 |
| Clone name | as00026 |
| Vector information | |
| cDNA sequence | DNA sequence (4577 bp) Predicted protein sequence (1180 aa) |
| Source | Human spleen |
Length: 4577 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).
| N-terminal truncation | Coding interruption | |
|---|---|---|
| cloned DNA seq | Warning | No warning |
Length: 1180 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against other entries from Kazusa human cDNA project
(FASTA output,
Multiple alignment)![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)
Result of InterProScan
| Search method | interpro_ID | From | To | Entry | Definition |
|---|---|---|---|---|---|
| HMMPfam | IPR010703 | 963 | 1142 | PF06920 | Dedicator of cytokinesis |
Prediction of transmembrane (TM) segments| Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 128 | KMNISLAFFLYDLLSLMDRGFVF | 150 | SECONDARY | 23 | 2 | 291 | KIAALYLPLVGIILDALPQLCDF | 313 | PRIMARY | 23 |
|---|
RT-PCR-ELISA
|
Experimental conditions| Primer_f | TGTGGGAGCTACTGTAAATCA |
|---|---|
| Primer_r | TTGAGTTCCTGCTGATATTCC |
| PCR conditions | 95 °C 30 sec 55 °C 30 sec 72 °C 60 sec 30 cycles![]() |