Order Kazusa clone(s) from : ![]() |
Product ID | ORK06761 |
---|---|
Accession No | AK024425 |
Clone name | as00014 |
Vector information | |
cDNA sequence | DNA sequence (4469 bp) Predicted protein sequence (725 aa) |
Source | Human spleen |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR001627 | 1 | 446 | PF01403 | Semaphorin/CD100 antigen |
IPR002165 | 464 | 517 | PF01437 | Plexin | |
IPR007110 | 539 | 600 | PF00047 | Immunoglobulin-like | |
HMMSmart | IPR003659 | 464 | 517 | SM00423 | Plexin/semaphorin/integrin |
ProfileScan | IPR007110 | 512 | 599 | PS50835 | Immunoglobulin-like |
![]() |
Primer_f | TGTAAGTCCCGCTGATTCTCG |
---|---|
Primer_r | TTCCAGCCAGTTTTGTGTGTC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |