Order Kazusa clone(s) from : ![]() |
Product ID | ORK05911 |
---|---|
Accession No | AB023152 |
Description | mannosidase, alpha, class 2B, member 2 |
Clone name | af13188 |
Vector information | |
cDNA sequence | DNA sequence (7720 bp) Predicted protein sequence (952 aa) |
Source | Human brain (amygdala) |
Rouge ID |
mKIAA0935
by Kazusa Mouse cDNA Project
|
Note | We replaced hh04630, former representative clones for KIAA0935 with af13188. (2005/08/06) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 4859 bp |
---|---|
Genome contig ID | gi89161207f_6527843 |
PolyA signal sequence (ATTAAA,-20) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (147188 - 147237) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 4 | f | 6627843 | 6675029 | 17 | 99.3 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
Primer_f | CACAAAACACAAACCCAGGAC |
---|---|
Primer_r | GGATGAGTCTATGAAAACACG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | UniGene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |