KIAA1998

Gene/Protein Characteristic Table for KIAA1998

Order Kazusa clone(s) from :

Product ID	ORK05742
Accession No	AB082529
Description	Rho guanine nucleotide exchange factor (GEF) 28
Clone name	bf00063
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector(Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGC TGAAGCTTTC ACAAGTTTGT ACAAAAAAGC AGGCTCTTC-5' end of cDNA, GAGCTCTCAC CACTTTGTAC AAGAAAGCTG GGCGGCCGCT TTTTTTTTTT TTTTTTT-3' end of cDNA).
cDNA sequence	DNA sequence (8407 bp) Predicted protein sequence (607 aa)
Source	Human adult brain
Rouge ID	mKIAA1998 by Kazusa Mouse cDNA Project

Features of the cloned cDNA sequence

Description

Length: 8407 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	6583 bp
Genome contig ID	gi51511721f_72916419
PolyA signal sequence (None)	+--------+--------+----*----+---- CTCCAGCCTAGGCAACGAGAGCAAAACTCCATCTC
Flanking genome sequence (270896 - 270945)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAGTTAAAGTGTCGTGTTGTAGAAGTATGAAGGATATA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	5	f	73016418	73187313	12	99.2	Perfect prediction

Features of the protein sequence

Description

Length: 607 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAC04405	100.0	unnamed protein...	Homo sapiens
AAI67854	100.0	Rho-guanine nuc...	synthetic construct
AAI71850	100.0	RGNEF protein [...	Homo sapiens
Q8N1W1	100.0	Rho-guanine nuc...	Homo sapiens
AAI57847	99.8	RGNEF protein [...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Expression profile

Description

RT-PCR-ELISA

Experimental conditions

Primer_f	TGGATTTTTGCCTAGTAGCCC
Primer_r	AATCATGCTTGCACACTGGTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information

Description

Chromosome No. 5

Experimental conditions

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp