Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK07376 |
---|---|
Accession No | AB067476 |
Description | XK, Kell blood group complex subunit-related family, member 4 |
Clone name | fk02634 |
Vector information | |
cDNA sequence | DNA sequence (3441 bp) Predicted protein sequence (505 aa) |
Source | Human fetal brain |
Rouge ID |
mKIAA1889
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 1922 bp |
---|---|
Genome contig ID | gi51511724f_56078037 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (523227 - 523276) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 8 | f | 56178037 | 56601262 | 3 | 100.0 | Perfect prediction |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
None | - | - | - | - | - |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 1 | GLTLFFVVLGSLSVQVFSFRWFV | 23 | SECONDARY | 23 | 2 | 180 | IVQTHSLQALQGFTAAASLVSLA | 202 | SECONDARY | 23 | 3 | 223 | SYMAVIIQFCWHFFTIAARVITF | 245 | PRIMARY | 23 | 4 | 252 | FQLYFGIFIVLHWCIMTFWIVHC | 274 | PRIMARY | 23 | 5 | 283 | WEEIVFDMVVGIIYIFSWFNVK | 304 | PRIMARY | 22 | 6 | 311 | RLFIYYFVILLENTALSALWYLY | 333 | PRIMARY | 23 | 7 | 342 | FAIPALCVVFSSFLTGVVFMLMY | 364 | PRIMARY | 23 |
---|
RT-PCR-ELISA |
Primer_f | CCATGTGTGAAAATCCTATCC |
---|---|
Primer_r | TCTGTCAAAAAGGATGTTCGC |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | genbank |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |