Gene/Protein Characteristic Table for KIAA1868
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK04178
Accession No AB058771
Description armadillo repeat containing 9
Clone name fj22550
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (3748 bp)
Predicted protein sequence (463 aa)
Source Human fetal brain
Rouge ID mKIAA1868 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 3748 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning Warning
Integrity of 3' end
Length of 3'UTR 2356 bp
Genome contig ID gi89161199f_231735302
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
CCCTGCACTCCAGCCTGGGCGACAGAGACTCCGTC
Flanking genome sequence None

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 2 f 231835302 231997420 17 98.4 Both No-hit
Features of the protein sequence
Description

Length: 463 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
EAW70956 8.2e-159 100.0 armadillo repea...
Homo sapiens
EAW70954 8.5e-159 100.0 armadillo repea...
Homo sapiens
Q7Z3E5 1e-157 99.8 LisH domain-con...
Homo sapiens
BAC32837 2.8e-122 81.2 unnamed protein...
Mus musculus
EDL40234 2.8e-122 81.2 armadillo repea...
Mus musculus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
No significant homologues
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f ATTCCGAAGAGCTACCAGATG
Primer_r TTCCCCGTGTTGGTCATGATC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 2
Experimental conditions
Panel name unigene
Primer_f -
Primer_r -
PCR product length -
PCR conditions -
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp