KIAA1863

Gene/Protein Characteristic Table for KIAA1863

Order Kazusa clone(s) from :

Product ID	ORK05724
Accession No	AB058766
Description	Fas (TNFRSF6) binding factor 1
Clone name	fj07583
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4270 bp) Predicted protein sequence (452 aa)
Source	Human fetal brain
Rouge ID	mKIAA1863 by Kazusa Mouse cDNA Project

Features of the cloned cDNA sequence

Description

Length: 4270 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	Warning

Integrity of 3' end

Length of 3'UTR	2829 bp
Genome contig ID	gi51511734r_71306834
PolyA signal sequence (None)	+--------+--------+----*----+---- CATGCGGGAGCCGGTGTTTGAGTTCGTGCGGCCGC
Flanking genome sequence (99793 - 99744)	----+--------+--------+--------+--------+----* CCCCTTACCACCCCAAGCAGAAGCGCTTCCCCCACCGGCAGCCCCTGCGC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	17	r	71406627	71437805	32	99.9	Perfect prediction

Features of the protein sequence

Description

Length: 452 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAW89343	1.2e-145	99.6	hCG1989313, iso...	Homo sapiens
EAW89346	6.9e-145	99.6	hCG1989313, iso...	Homo sapiens
AAH23549	2.1e-128	100.0	Fas (TNFRSF6) b...	Homo sapiens
BAG71501	2.7e-128	100.0	Albatross [Homo...	Homo sapiens
EAW89341	1.9e-127	99.5	hCG1989313, iso...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Expression profile

Description

RT-PCR-ELISA

Experimental conditions

Primer_f	GTGACATCGACTTGAGCAACC
Primer_r	CAGCCCAATATCAATCTTCTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information

Description

Chromosome No. 17

Experimental conditions

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp