|
Order Kazusa clone(s) from : |
| Product ID | ORK02057 |
|---|---|
| Accession No | AB058742 |
| Description | RNA-binding region (RNP1, RRM) containing 3 |
| Clone name | fh00676 |
| Vector information | |
| cDNA sequence | DNA sequence (5385 bp) Predicted protein sequence (541 aa) |
|
HaloTag ORF Clone |
FHC02057
|
| Flexi ORF Clone | FXC02057 |
| Source | Human fetal brain |
| Rouge ID |
mKIAA1839
by Kazusa Mouse cDNA Project
|
| Note | We replaced fj11961, former representative clones for KIAA1839 with fh00676. (2001/6/05) |
Length: 5385 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).
| N-terminal truncation | Coding interruption | |
|---|---|---|
| cloned DNA seq | No warning | Warning |
Integrity of 3' end
| Length of 3'UTR | 3615 bp |
|---|---|
| Genome contig ID | gi89161185f_103740929 |
| PolyA signal sequence (ATTAAA,-17) |
+----*----+----*----+----*----+---- |
| Flanking genome sequence (182743 - 182792) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
| Chr | f/r | start | end | exon | identity | class | |
|---|---|---|---|---|---|---|---|
|
| 1 | f | 103840929 | 103923670 | 17 | 100.0 | Internal No-hit |
Length: 541 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database
(FASTA output,
Multiple alignment)
Result of motif / domain search (InterProScan and SOSUI)
Result of InterProScan
| Search method | interpro_ID | From | To | Entry | Definition |
|---|---|---|---|---|---|
| HMMPfam | IPR000504 | 53 | 121 | PF00076 | RNA recognition motif |
| IPR000504 | 446 | 522 | PF00076 | RNA recognition motif | |
| HMMSmart | IPR000504 | 52 | 122 | SM00360 | RNA recognition motif |
| IPR000504 | 445 | 523 | SM00360 | RNA recognition motif | |
| ProfileScan | IPR000504 | 51 | 126 | PS50102 | RNA recognition motif |
| IPR000504 | 444 | 527 | PS50102 | RNA recognition motif |
Experimental conditions| Primer_f | CATGGTGGTTCAGTTTGCTCG |
|---|---|
| Primer_r | CACTGCCCCAAAAAGGATACG |
| PCR conditions | 95 °C 30 sec 55 °C 30 sec 72 °C 60 sec 30 cycles![]() |
Chromosome No. 1
Experimental conditions| Panel name | unigene |
|---|---|
| Primer_f | - |
| Primer_r | - |
| PCR product length | - |
| PCR conditions | - |