KIAA1839

Product ID	ORK02057
Accession No	AB058742
Description	RNA-binding region (RNP1, RRM) containing 3
Clone name	fh00676
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5385 bp) Predicted protein sequence (541 aa)
HaloTag ORF Clone	FHC02057
Flexi ORF Clone	FXC02057
Source	Human fetal brain
Rouge ID	mKIAA1839 by Kazusa Mouse cDNA Project
Note	We replaced fj11961, former representative clones for KIAA1839 with fh00676. (2001/6/05)

Length: 5385 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	Warning

Integrity of 3' end

Length of 3'UTR	3615 bp
Genome contig ID	gi89161185f_103740929
PolyA signal sequence (ATTAAA,-17)	+--------+--------+----*----+---- TAAATTATAAAATTTAAAATTAAATGCATATCCTC
Flanking genome sequence (182743 - 182792)	----+--------+--------+--------+--------+----* AAAACAATAGCCAAGTGTGTTTCTTTTCTTACATATACAGTAATACTTAT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	f	103840929	103923670	17	100.0	Internal No-hit

Length: 541 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q96LT9	5e-184	100.0	RNA-binding pro...	Homo sapiens
BAF82533	4.4e-183	99.8	unnamed protein...	Homo sapiens
Q5R6C7	5e-183	99.2	RNA-binding pro...	Pongo abelii
Q3MHP0	1.5e-171	93.2	RNA-binding pro...	Bos taurus
XP_547257	3.2e-171	92.5	similar to RNA-...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000504	53	121	PF00076	RNA recognition motif
HMMPfam	IPR000504	446	522	PF00076	RNA recognition motif
HMMSmart	IPR000504	52	122	SM00360	RNA recognition motif
HMMSmart	IPR000504	445	523	SM00360	RNA recognition motif
ProfileScan	IPR000504	51	126	PS50102	RNA recognition motif
ProfileScan	IPR000504	444	527	PS50102	RNA recognition motif

Primer_f	CATGGTGGTTCAGTTTGCTCG
Primer_r	CACTGCCCCAAAAAGGATACG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-