Order Kazusa clone(s) from : ![]() |
Product ID | ORK02057 |
---|---|
Accession No | AB058742 |
Description | RNA-binding region (RNP1, RRM) containing 3 |
Clone name | fh00676 |
Vector information | |
cDNA sequence | DNA sequence (5385 bp) Predicted protein sequence (541 aa) |
HaloTag ORF Clone |
FHC02057
![]() |
Flexi ORF Clone | FXC02057 |
Source | Human fetal brain |
Rouge ID |
mKIAA1839
by Kazusa Mouse cDNA Project
|
Note | We replaced fj11961, former representative clones for KIAA1839 with fh00676. (2001/6/05) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | Warning |
Length of 3'UTR | 3615 bp |
---|---|
Genome contig ID | gi89161185f_103740929 |
PolyA signal sequence (ATTAAA,-17) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (182743 - 182792) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 1 | f | 103840929 | 103923670 | 17 | 100.0 | Internal No-hit |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR000504 | 53 | 121 | PF00076 | RNA recognition motif |
IPR000504 | 446 | 522 | PF00076 | RNA recognition motif | |
HMMSmart | IPR000504 | 52 | 122 | SM00360 | RNA recognition motif |
IPR000504 | 445 | 523 | SM00360 | RNA recognition motif | |
ProfileScan | IPR000504 | 51 | 126 | PS50102 | RNA recognition motif |
IPR000504 | 444 | 527 | PS50102 | RNA recognition motif |
Primer_f | CATGGTGGTTCAGTTTGCTCG |
---|---|
Primer_r | CACTGCCCCAAAAAGGATACG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |