Order Kazusa clone(s) from : ![]() |
Product ID | ORK05341 |
---|---|
Accession No | AB058731 |
Description | adhesion G protein-coupled receptor A1 |
Clone name | ha06249 |
Vector information | |
cDNA sequence | DNA sequence (3536 bp) Predicted protein sequence (496 aa) |
Source | Human adult brain |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 2015 bp |
---|---|
Genome contig ID | gi89161187f_134665740 |
PolyA signal sequence (AATACA,-20) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (129184 - 129233) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 10 | f | 134765740 | 134794922 | 5 | 99.5 | Internal No-hit |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
ProfileScan | IPR000832 | 22 | 246 | PS50261 | GPCR |
ScanRegExp | IPR000832 | 234 | 249 | PS00650 | GPCR |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 19 | PIQVGIVLHYSTLSTMLWIGVTA | 41 | SECONDARY | 23 | 2 | 68 | LLRFYLVSGGVPFIICGVTAATN | 90 | SECONDARY | 23 | 3 | 115 | FYGPAAIITLVTCVYFLGTYVQ | 136 | PRIMARY | 22 | 4 | 192 | LRAAAFTLFLFTATWAFGALAVS | 214 | SECONDARY | 23 | 5 | 221 | MVFSCLYGAFCVTLGLFVLIHHC | 243 | PRIMARY | 23 |
---|
![]() |
Primer_f | ATCTACAAGCAGGTGACCAAG |
---|---|
Primer_r | TCCTCTGTCCCGTAATTCCTG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | genbank |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |