Order Kazusa clone(s) from : ![]() |
Product ID | ORK00909 |
---|---|
Accession No | AB051535 |
Description | zinc finger, DHHC-type containing 5 |
Clone name | pj02084 |
Vector information | |
cDNA sequence | DNA sequence (4545 bp) Predicted protein sequence (758 aa) |
HaloTag ORF Clone |
FHC00909
![]() |
Flexi ORF Clone | FXC00909 |
Source | Human brain (hippocampus) |
Rouge ID |
mKIAA1748
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 1149 bp |
---|---|
Genome contig ID | gi51511727f_57092058 |
PolyA signal sequence (AATAAA,-21) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (133172 - 133221) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 11 | f | 57192058 | 57225228 | 12 | 99.7 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR001594 | 147 | 182 | PD003041 | Zinc finger |
HMMPfam | IPR001594 | 138 | 202 | PF01529 | Zinc finger |
ProfileScan | IPR001594 | 147 | 197 | PS50216 | Zinc finger |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 8 | SFVLLSVASLLPFSCLFCRCVGL | 30 | PRIMARY | 23 | 2 | 59 | PVSAAAIFLVGATTLFFAFTCPG | 81 | PRIMARY | 23 | 3 | 88 | PAVPIYNAIMFLFVLANFSMATF | 110 | PRIMARY | 23 | 4 | 193 | FLFLLSLTAHIMGVFGFGLLYVL | 215 | PRIMARY | 23 | 5 | 230 | MAVMCVAGLFFIPVAGLTGFHVV | 252 | PRIMARY | 23 |
---|
![]() |
Primer_f | AGTTGCAATCCATTCGTTCAG |
---|---|
Primer_r | GGTATAGCCTAAAGGTGGGTC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |