KIAA1704

Gene/Protein Characteristic Table for KIAA1704

Order Kazusa clone(s) from :

Product ID	ORK00891
Accession No	AB051491
Description	GPALPP motifs containing 1
Clone name	fj16938
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4030 bp) Predicted protein sequence (351 aa)
HaloTag ORF Clone	FHC00891
Flexi ORF Clone	FXC00891
Source	Human fetal brain
Rouge ID	mKIAA1704 by Kazusa Mouse cDNA Project

Features of the cloned cDNA sequence

Description

Length: 4030 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	2972 bp
Genome contig ID	gi51511729f_44361755
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- TTTTTTATGTATAAATAAAGTTTTATCTATATCTG
Flanking genome sequence (143989 - 144038)	----+--------+--------+--------+--------+----* AGAAGTTGTAGTATTTATTTTTGTTTTAACATTATTAGCTTTTCTGAAGC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	13	f	44461755	44505742	12	99.2	Perfect prediction

Features of the protein sequence

Description

Length: 351 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAE89642	1.3e-108	97.7	unnamed protein...	Macaca fascicularis
XP_001094145	2.6e-108	97.1	similar to F26A...	Macaca mulatta
BAE88065	8.6e-108	96.8	unnamed protein...	Macaca fascicularis
XP_851499	8.6e-102	91.9	similar to CG33...	Canis lupus fam...
XP_001363803	2.1e-89	81.7	similar to pol ...	Monodelphis dom...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Expression profile

Description

RT-PCR-ELISA

Experimental conditions

Primer_f	TTGCTTCCAGGAGTTACTACC
Primer_r	TCCGTCCTGTGCAATAACTAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information

Description

Chromosome No. 17

Experimental conditions

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp