KIAA1669

Product ID	ORK07248
Accession No	AB051456
Description	tubulin, gamma complex associated protein 6
Clone name	fh18133
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5605 bp) Predicted protein sequence (1405 aa)
Source	Human fetal brain
Rouge ID	mKIAA1669 by Kazusa Mouse cDNA Project

Length: 5605 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	Warning

Integrity of 3' end

Length of 3'UTR	1385 bp
Genome contig ID	gi89161203r_48898251
PolyA signal sequence (AATAAA,-17)	+--------+--------+----*----+---- TCTGCGGGGGACGTGCACAATAAAGGTGTTCTCGG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACCCTGTCTGCAGCTCTCTCTCCTGGGTGGGGGCTGAGGACAGGGCAGGG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	22	r	48998251	49024921	24	99.9	Perfect prediction

Length: 1405 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW73509	99.9	tubulin, gamma ...	Homo sapiens
AAI51210	99.1	TUBGCP6 protein...	Homo sapiens
Q96RT7	98.7	Gamma-tubulin c...	Homo sapiens
NP_065194	98.7	tubulin, gamma ...	Homo sapiens
EAW73508	98.6	tubulin, gamma ...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007259	320	1239	PF04130	Spc97/Spc98

Primer_f
Primer_r
PCR conditions	test

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-