KIAA1598

Gene/Protein Characteristic Table for KIAA1598

Order Kazusa clone(s) from :

Product ID	ORK05677
Accession No	AB046818
Description	KIAA1598
Clone name	fj09914
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3099 bp) Predicted protein sequence (446 aa)
Source	Human fetal brain
Rouge ID	mKIAA1598 by Kazusa Mouse cDNA Project

Features of the cloned cDNA sequence

Description

Length: 3099 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	Warning

Integrity of 3' end

Length of 3'UTR	1758 bp
Genome contig ID	gi89161187r_118534298
PolyA signal sequence (ATTAAA,-28)	+--------+--------+----*----+---- ACAACTTATTAAAAAGGCACCAATAGTTTCCCATT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAGGGTCAGTTGTGGTTATTATTAACGTTTCTGGTTTAGTTCCCCAAGCT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	10	r	118634298	118754550	15	100.0	Perfect prediction

Features of the protein sequence

Description

Length: 446 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
CAH18259	3e-106	99.6	hypothetical pr...	Homo sapiens
A0MZ66	4.7e-106	99.3	Shootin-1.	Homo sapiens
CAH91407	9.4e-106	98.7	hypothetical pr...	Pongo abelii
XP_521613	1.4e-104	99.1	hypothetical pr...	Pan troglodytes
XP_001494761	3.7e-102	96.0	similar to Shoo...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Expression profile

Description

RT-PCR-ELISA

Experimental conditions

Primer_f	CTTGACTGTTTCCATGTTCTC
Primer_r	GAGGAGAGTTCAAATTACAGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information

Description

Chromosome No. 10

Experimental conditions

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp