KIAA1583

Product ID	ORK07142
Accession No	AB046803
Description	transmembrane protein 132A
Clone name	fj06651
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3981 bp) Predicted protein sequence (435 aa)
Source	Human fetal brain
Rouge ID	mKIAA1583 by Kazusa Mouse cDNA Project

Length: 3981 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	2673 bp
Genome contig ID	gi51511727f_60351116
PolyA signal sequence (None)	+--------+--------+----*----+---- CCCCCTTCGCGGCCCACCCGCTGGACGGCGGCCGC
Flanking genome sequence (107551 - 107600)	----+--------+--------+--------+--------+----* CGCCTCACGCACCTGCTTGGCCCCGACTGGCTGCTAGACGTGTCCCACCT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	11	f	60451116	60458665	5	100.0	Perfect prediction

Length: 435 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAW73912	9.8e-170	100.0	transmembrane p...	Homo sapiens
XP_001142704	3.9e-151	99.5	transmembrane p...	Pan troglodytes
XP_001143180	3.4e-150	99.2	transmembrane p...	Pan troglodytes
AAH28106	1.3e-143	100.0	TMEM132A protei...	Homo sapiens
EAW73909	1.6e-143	100.0	transmembrane p...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB058689	6.5e-07	29.9	KIAA1786

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Primer_f	CTCCCTCTTATGCCTCTTCAG
Primer_r	GCTGTAGGAGCAGAAAGGTCT
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-