Order Kazusa clone(s) from : ![]() |
Product ID | ORK00869 |
---|---|
Accession No | AB046801 |
Description | ANKH inorganic pyrophosphate transport regulator |
Clone name | fj05690 |
Vector information | |
cDNA sequence | DNA sequence (3928 bp) Predicted protein sequence (545 aa) |
HaloTag ORF Clone |
FHC00869
![]() |
Flexi ORF Clone | FXC00869 |
Source | Human fetal brain |
Rouge ID |
mKIAA1581
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 5 | r | 14762019 | 14924725 | 12 | 99.1 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR009887 | 54 | 545 | PF07260 | Progressive ankylosis |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 139 | AVLCMVVAGAIAAVFHTLIAYSD | 161 | PRIMARY | 23 | 2 | 184 | AFLYLAAFPFMDAMAWTHAGI | 204 | SECONDARY | 21 | 3 | 213 | LVGCASISDVIAQVVFVAILLHS | 235 | PRIMARY | 23 | 4 | 244 | LIPILSLYMGALVRCTTLCLGYY | 266 | SECONDARY | 23 | 5 | 380 | FTFVCMALSLTLCFVMFWTPNVS | 402 | PRIMARY | 23 | 6 | 409 | IIGVDFAFAELCVVPLRIFSFFP | 431 | PRIMARY | 23 | 7 | 451 | FVLAPSSVLRIIVLIASLVVLPY | 473 | PRIMARY | 23 | 8 | 481 | LGVGSLLAGFVGESTMVAIAAC | 502 | SECONDARY | 22 |
---|
![]() |
Primer_f | GCCCACATCAAGAAGTTCACC |
---|---|
Primer_r | TGACTGGAACTGGGAAGAAGG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | RH-map |
---|---|
Primer_f | ACAGGTTAAAACTCGGCTTCC |
Primer_r | GAAATTTAAGAGGCCACCGGG |
PCR product length | 86 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |