KIAA1558

Product ID	ORK01175
Accession No	AB046778
Description	protein phosphatase 6, regulatory subunit 3, transcript variant 4
Clone name	hj01607
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5059 bp) Predicted protein sequence (882 aa)
HaloTag ORF Clone	FHC01175
Flexi ORF Clone	FXC01175
Source	Human adult brain
Rouge ID	mKIAA1558 by Kazusa Mouse cDNA Project
Note	We replaced fh19035, former representative clones for KIAA1558 with hj01607. (2001/2/22)

Length: 5059 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	2204 bp
Genome contig ID	gi51511727f_67884814
PolyA signal sequence (AATAAA,-26)	+--------+--------+----*----+---- AATAACAAAAATAAAGCCTGATTCTTTGTTTCTAG
Flanking genome sequence (254563 - 254612)	----+--------+--------+--------+--------+----* AAATCTCTTGTACCTTGCTTGGATTTTTAATGGGTTGATGTGTCCTGCCA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	11	f	67984814	68139375	24	99.3	Perfect prediction

Length: 882 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG11337	100.0	SAPS domain fam...	synthetic construct
Q5H9R7	99.2	Serine/threonin...	Homo sapiens
XP_001173680	99.0	SAPS domain fam...	Pan troglodytes
CAI45957	99.0	hypothetical pr...	Homo sapiens
EAW74707	98.6	SAPS domain fam...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB029038	4.3e-89	46.6	KIAA1115
AB014585	5.7e-74	46.4	KIAA0685

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007587	131	516	PF04499	SIT4 phosphatase-associated protein