KIAA1502

Product ID	ORK04526
Accession No	AB040935
Description	cerebral endothelial cell adhesion molecule
Clone name	hk02042
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4594 bp) Predicted protein sequence (560 aa)
Source	Human adult brain

Length: 4594 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	0 bp
Genome contig ID	gi89161216f_130113866
PolyA signal sequence (None)	+--------+--------+----*----+---- AGACATCCTCTCCATGGGATGATGACAGCGGCCGC
Flanking genome sequence (124036 - 124085)	----+--------+--------+--------+--------+----* CTCATCAGCTGGAGCGGCTCCCAAAAGACCCTGCGCAGCCCCCGCCTGGA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	9	f	130213866	130237900	13	99.3	Perfect prediction

Length: 560 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW87790	100.0	cerebral endoth...	Homo sapiens
EAW87788	100.0	cerebral endoth...	Homo sapiens
Q5T4B2	100.0	Glycosyltransfe...	Homo sapiens
AAI08699	100.0	CERCAM protein ...	Homo sapiens
XP_001157210	98.8	cerebral endoth...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB011156	1.3e-121	54.4	KIAA0584

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002654	318	502	PF01755	Glycosyl transferase

Primer_f	TTGGGACCTGATCTACCTTGG
Primer_r	AACATGATGGGCAGGAACTCG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-