KIAA1467

Gene/Protein Characteristic Table for KIAA1467

Order Kazusa clone(s) from :

Product ID	ORK05663
Accession No	AB040900
Description	KIAA1467
Clone name	fj01477
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4114 bp) Predicted protein sequence (432 aa)
Source	Human fetal brain
Rouge ID	mKIAA1467 by Kazusa Mouse cDNA Project

Features of the cloned cDNA sequence

Description

Length: 4114 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	2815 bp
Genome contig ID	gi89161190f_13005814
PolyA signal sequence (AATAAA,-17)	+--------+--------+----*----+---- ACTGTTATAGAGTAAATAAATAAATACTCTACAGG
Flanking genome sequence (121836 - 121885)	----+--------+--------+--------+--------+----* AATACACTTGTGTGCCATTCTCATTCGTCTTAGTCATCAAGGATGGTTTG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	12	f	13105814	13127648	10	99.3	Perfect prediction

Features of the protein sequence

Description

Length: 432 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAC86111	3e-183	100.0	unnamed protein...	Homo sapiens
CAI56785	7.7e-183	99.8	hypothetical pr...	Homo sapiens
XP_001087297	1.5e-181	98.4	similar to CG61...	Macaca mulatta
XP_543805	1.2e-166	89.6	similar to CG61...	Canis lupus fam...
BAB31206	4e-161	87.3	unnamed protein...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Expression profile

Description

RT-PCR-ELISA

Experimental conditions

Primer_f	TTTGGAAGTCATCTGTGGGTC
Primer_r	AGTTTTGGGTATTCAGCTGCC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information

Description

Chromosome No. 12

Experimental conditions

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp