Order Kazusa clone(s) from : ![]() |
Product ID | ORK01169 |
---|---|
Accession No | AB040890 |
Description | phosphatidylinositol transfer protein, membrane-associated 2, transcript variant 2 |
Clone name | fh16161s1 |
Vector information | |
cDNA sequence | DNA sequence (6799 bp) Predicted protein sequence (1359 aa) |
HaloTag ORF Clone |
FHC01169
![]() |
Flexi ORF Clone | FXC01169 |
Source | Human fetal brain |
Rouge ID |
mKIAA1457
by Kazusa Mouse cDNA Project
|
Note | We replaced fh16161, former representative clones for KIAA1457 with fh16161s1. (2002/12/27) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 2546 bp |
---|---|
Genome contig ID | gi89161190r_121933981 |
PolyA signal sequence (ATTAAA,-21) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 12 | r | 122033981 | 122160996 | 25 | 99.5 | Terminal No-hit |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR001666 | 32 | 51 | PR00391 | Phosphatidylinositol transfer protein |
IPR001666 | 101 | 121 | PR00391 | Phosphatidylinositol transfer protein | |
IPR001666 | 127 | 142 | PR00391 | Phosphatidylinositol transfer protein | |
IPR001666 | 214 | 229 | PR00391 | Phosphatidylinositol transfer protein | |
IPR001666 | 235 | 254 | PR00391 | Phosphatidylinositol transfer protein | |
HMMPfam | IPR001666 | 17 | 269 | PF02121 | Phosphatidylinositol transfer protein |
IPR004177 | 731 | 973 | PF02862 | DDHD | |
IPR013209 | 1118 | 1249 | PF08235 | LNS2 | |
HMMSmart | IPR013209 | 1118 | 1249 | SM00775 | LNS2 |
ProfileScan | IPR004177 | 731 | 973 | PS51043 | DDHD |
![]() |
Primer_f | CCCTCCACACTGAAAACACCC |
---|---|
Primer_r | TCGGCATGAAAACGGAATTGG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | CCCTCCACACTGAAAACACCC |
Primer_r | TCGGCATGAAAACGGAATTGG |
PCR product length | 196 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |