Order Kazusa clone(s) from : ![]() |
Product ID | ORK01161 |
---|---|
Accession No | AB037772 |
Description | WD repeat domain 11 |
Clone name | fj01021s1 |
Vector information | |
cDNA sequence | DNA sequence (4548 bp) Predicted protein sequence (1243 aa) |
HaloTag ORF Clone |
FHC01161
![]() |
Flexi ORF Clone | FXC01161 |
Source | Human fetal brain |
Rouge ID |
mKIAA1351
by Kazusa Mouse cDNA Project
|
Note | We replaced fj01021, former representative clones for KIAA1351 with fj01021s1. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 814 bp |
---|---|
Genome contig ID | gi89161187f_122500864 |
PolyA signal sequence (AATAAA,-21) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (158163 - 158212) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 10 | f | 122600864 | 122659025 | 29 | 99.6 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR001680 | 70 | 118 | PF00400 | WD40 repeat |
IPR001680 | 730 | 755 | PF00400 | WD40 repeat | |
HMMSmart | IPR001680 | 69 | 118 | SM00320 | WD40 repeat |
IPR001680 | 121 | 164 | SM00320 | WD40 repeat | |
IPR001680 | 572 | 615 | SM00320 | WD40 repeat | |
IPR001680 | 716 | 755 | SM00320 | WD40 repeat | |
IPR001680 | 757 | 797 | SM00320 | WD40 repeat | |
IPR001680 | 800 | 841 | SM00320 | WD40 repeat | |
ScanRegExp | IPR001680 | 105 | 119 | PS00678 | WD40 repeat |
IPR001680 | 390 | 404 | PS00678 | WD40 repeat | |
IPR001680 | 742 | 756 | PS00678 | WD40 repeat | |
IPR001907 | 869 | 882 | PS00382 | Peptidase S14 |
![]() |
Primer_f | CCACTACCTGCACAGCTTATC |
---|---|
Primer_r | TCACTTCCTGTAGATTAACCC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |