KIAA1350

Product ID	ORK00812
Accession No	AB037771
Description	ubiquitin specific peptidase 53
Clone name	fj00953
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4153 bp) Predicted protein sequence (911 aa)
Flexi ORF Clone	FXC00812
Source	Human fetal brain
Rouge ID	mKIAA1350 by Kazusa Mouse cDNA Project

Length: 4153 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1416 bp
Genome contig ID	gi89161207f_120297043
PolyA signal sequence (AATAAA,-17)	+--------+--------+----*----+---- TGGATAAACCTCATATTCAATAAACTAGTAAATGT
Flanking genome sequence (138190 - 138239)	----+--------+--------+--------+--------+----* AGCCACTTGACTGATTGCGTAAATCGTGTTAAAACATTCTAAAATGTTGT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	4	f	120397043	120435231	11	99.4	Perfect prediction

Length: 911 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q70EK8	99.9	Inactive ubiqui...	Homo sapiens
CAE47751	99.8	ubiquitin speci...	Homo sapiens
CAH18315	99.6	hypothetical pr...	Homo sapiens
XP_517410	99.0	ubiquitin speci...	Pan troglodytes
XP_001098826	95.6	similar to ubiq...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Primer_f	CTCAACTAACGATTTTCAGGC
Primer_r	TGTATCCGTCATGCAGCTATC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Chromosome No. 4

Experimental conditions

Panel name	GeneBridge 4
Primer_f	CTCAACTAACGATTTTCAGGC
Primer_r	TGTATCCGTCATGCAGCTATC
PCR product length	139 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles