KIAA1315

Product ID	ORK01686
Accession No	AB037736
Description	caspase 8 associated protein 2
Clone name	fh12764s1
Vector information	The cDNA fragment was originally inserted at SalI-NotI site ... The cDNA fragment was originally inserted at SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR) and a RT-PCR product (1-1816) was subcloned upstream of the cDNA (1817-6834). The adjacent sequence to the 5' end of the cDNA is as follows: GGGCCCCCCC TCGAGGTCGA CCCACGCGGG CCGCGAATTC ACTAGTGATT-5' end of cDNA.
cDNA sequence	DNA sequence (6834 bp) Predicted protein sequence (1981 aa)
HaloTag ORF Clone	FHC01686
Flexi ORF Clone	FXC01686
Source	Human fetal brain
Rouge ID	mKIAA1315 by Kazusa Mouse cDNA Project
Note	We replaced fh12764, former representative clones for KIAA1315 with fh12764s1. (2002/5/10)

Length: 6834 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	888 bp
Genome contig ID	gi89161210f_90513030
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- ATAACAGTAATGTATAATAAAACCATGTAAAGTTT
Flanking genome sequence (127841 - 127890)	----+--------+--------+--------+--------+----* TGTTGTATTTTGATTCGAATGTTTCTTTTACTTTTATTGTGTTTAGGTAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	6	f	90613030	90640869	9	99.2	Internal No-hit

Length: 1981 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9UKL3	100.0	CASP8-associate...	Homo sapiens
AAD45537	99.7	FLASH homolog R...	Homo sapiens
XP_001159871	99.3	CASP8 associate...	Pan troglodytes
CAI16239	99.9	CASP8 associate...	Homo sapiens
XP_001098220	95.5	similar to CASP...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB046826	0.00054	29.4	KIAA1606

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Primer_f	TGAGAGACATCCAGTTGAGTT
Primer_r	GCAATATCAGTTAAGAGTCCC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-