KIAA1300

Gene/Protein Characteristic Table for KIAA1300

Order Kazusa clone(s) from :

Product ID	ORK05650
Accession No	AB037721
Description	StAR-related lipid transfer (START) domain containing 9
Clone name	fg06819
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6747 bp) Predicted protein sequence (1820 aa)
Source	Human fetal brain
Rouge ID	mKIAA1300 by Kazusa Mouse cDNA Project

Features of the cloned cDNA sequence

Description

Length: 6747 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1283 bp
Genome contig ID	gi51511731f_40669708
PolyA signal sequence (None)	+--------+--------+----*----+---- TGATTGAAGGTTTTTTAAAATTGCTTTTAAACTTC
Flanking genome sequence (130641 - 130690)	----+--------+--------+--------+--------+----* TATTTCTCGGGTAAATTTTTTGGTGACATGATATATTTAACACCCTATTT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	15	f	40769708	40800347	11	99.2	Perfect prediction

Features of the protein sequence

Description

Length: 1820 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9P2P6	99.8	StAR-related li...	Homo sapiens
XP_510339	97.8	START domain co...	Pan troglodytes
EAW92575	99.9	hCG1786640 [Hom...	Homo sapiens
XP_001105580	90.2	START domain co...	Macaca mulatta
XP_001500670	70.8	similar to StAR...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
ProfileScan	IPR002913	1685	1820	PS50848	Lipid-binding START

Expression profile

Description

RT-PCR-ELISA

Experimental conditions

Primer_f	TCATCTTTAGTTCTGGTGCCC
Primer_r	AACACATCTCTGCCACACTAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information

Description

Chromosome No. 15

Experimental conditions

Panel name	GeneBridge 4
Primer_f	CTGCCAGATCAAAGACCAAGC
Primer_r	TGAGAACTGCATGGCTGTCGG
PCR product length	182 bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp