Order Kazusa clone(s) from : ![]() |
Product ID | ORK01681 |
---|---|
Accession No | AB033033 |
Description | myoferlin, transcript variant 1 |
Clone name | fg04512s1 |
Vector information | |
cDNA sequence | DNA sequence (6719 bp) Predicted protein sequence (2061 aa) |
HaloTag ORF Clone |
FHC01681
![]() |
Flexi ORF Clone | FXC01681 |
Source | Human fetal brain |
Rouge ID |
mKIAA1207
by Kazusa Mouse cDNA Project
|
Note | We replaced fg04512, former representative clones for KIAA1207 with fg04512s1. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 533 bp |
---|---|
Genome contig ID | gi89161187r_94956177 |
PolyA signal sequence (AATAAA,-20) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 10 | r | 95056177 | 95231941 | 53 | 99.7 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR000008 | 1570 | 1582 | PR00360 | C2 calcium-dependent membrane targeting |
IPR000008 | 1596 | 1609 | PR00360 | C2 calcium-dependent membrane targeting | |
IPR000008 | 1618 | 1626 | PR00360 | C2 calcium-dependent membrane targeting | |
HMMPfam | IPR000008 | 2 | 85 | PF00168 | C2 calcium-dependent membrane targeting |
IPR000008 | 201 | 281 | PF00168 | C2 calcium-dependent membrane targeting | |
IPR012968 | 282 | 353 | PF08151 | FerI | |
IPR000008 | 360 | 458 | PF00168 | C2 calcium-dependent membrane targeting | |
IPR012560 | 676 | 741 | PF08165 | FerA | |
IPR012561 | 768 | 843 | PF08150 | FerB | |
IPR000008 | 1141 | 1231 | PF00168 | C2 calcium-dependent membrane targeting | |
IPR000008 | 1303 | 1393 | PF00168 | C2 calcium-dependent membrane targeting | |
IPR000008 | 1555 | 1638 | PF00168 | C2 calcium-dependent membrane targeting | |
HMMSmart | IPR000008 | 1 | 100 | SM00239 | C2 calcium-dependent membrane targeting |
IPR000008 | 200 | 299 | SM00239 | C2 calcium-dependent membrane targeting | |
IPR000008 | 359 | 473 | SM00239 | C2 calcium-dependent membrane targeting | |
IPR006613 | 856 | 914 | SM00693 | Dysferlin | |
IPR006613 | 927 | 983 | SM00693 | Dysferlin | |
IPR006614 | 992 | 1030 | SM00694 | Dysferlin | |
IPR006614 | 1050 | 1083 | SM00694 | Dysferlin | |
IPR000008 | 1140 | 1247 | SM00239 | C2 calcium-dependent membrane targeting | |
IPR000008 | 1302 | 1409 | SM00239 | C2 calcium-dependent membrane targeting | |
IPR000008 | 1554 | 1653 | SM00239 | C2 calcium-dependent membrane targeting | |
IPR000008 | 1789 | 1919 | SM00239 | C2 calcium-dependent membrane targeting | |
ProfileScan | IPR000008 | 1 | 85 | PS50004 | C2 calcium-dependent membrane targeting |
IPR000008 | 200 | 281 | PS50004 | C2 calcium-dependent membrane targeting | |
IPR000008 | 359 | 458 | PS50004 | C2 calcium-dependent membrane targeting | |
IPR000008 | 1126 | 1231 | PS50004 | C2 calcium-dependent membrane targeting | |
IPR000008 | 1538 | 1638 | PS50004 | C2 calcium-dependent membrane targeting |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 2026 | WVIIGLLFLLILLLFVAVLLYSL | 2048 | PRIMARY | 23 |
---|
![]() |
Primer_f | GGACGAACCCAACATGAACCC |
---|---|
Primer_r | GACAAATAGTTCGGCAAAGAG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | TTCCCAGACCCCTATGATGAG |
Primer_r | TATTTCTCAACAACCAGCAGG |
PCR product length | 158(1.3k) bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |