Order Kazusa clone(s) from : ![]() |
Product ID | ORK05638 |
---|---|
Accession No | AB032974 |
Description | tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 2 |
Clone name | bg00390 |
Vector information | |
cDNA sequence | DNA sequence (7384 bp) Predicted protein sequence (543 aa) |
Source | Human adult brain |
Rouge ID |
mKIAA1148
by Kazusa Mouse cDNA Project
|
Note | We replaced hg00436, former representative clones for KIAA1148 with bg00390. (2002/12/27) Please refer to "Gene/Protein Characteristic Table for KIAA1636" because the cDNA sequence of KIAA1148 is included in KIAA1636. |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 5750 bp |
---|---|
Genome contig ID | gi51511734f_58751415 |
PolyA signal sequence (TATAAA,-26) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (107385 - 107434) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 17 | f | 58851415 | 58858798 | 1 | 100.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
Primer_f | ATCTCCACTTCATTCACAGGT |
---|---|
Primer_r | CAAAGATGCTGTGCTAGATGG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |