Order Kazusa clone(s) from : ![]() |
Product ID | ORK05344 |
---|---|
Accession No | AB032962 |
Description | G protein-coupled receptor 158 |
Clone name | hj01467 |
Vector information | |
cDNA sequence | DNA sequence (4789 bp) Predicted protein sequence (596 aa) |
Source | Human adult brain |
Rouge ID |
mKIAA1136
by Kazusa Mouse cDNA Project
|
Note | We replaced hj02663, former representative clones for KIAA1136 with hj01467. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 2952 bp |
---|---|
Genome contig ID | gi89161187f_25823148 |
PolyA signal sequence (AATAAA,-19) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (108015 - 108064) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 10 | f | 25923144 | 25931161 | 3 | 99.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
Primer_f | AATCACTCAGAAATAGAACCG |
---|---|
Primer_r | TAAGAACAGCCCTATATCCAC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |