| Order Kazusa clone(s) from :  Japan
 || 
Other countries | 
| Product ID | ORK01149 | 
|---|---|
| Accession No | AB029034 | 
| Description | PHD finger protein 8, transcript variant 1 | 
| Clone name | hj04651s1 | 
| Vector information | |
| cDNA sequence | DNA sequence (4695 bp) Predicted protein sequence (1084 aa) | 
| 
    HaloTag ORF Clone | 
    FHC01149
       | 
| Flexi ORF Clone | FXC01149 | 
| Source | Human adult brain | 
| Rouge ID | mKIAA1111
    
    by Kazusa Mouse cDNA Project | 
| Note | We replaced hj04651, former representative clones for KIAA1111 with hj04651s1. (2002/5/10) | 
 Length: 4695 bp
 Length: 4695 bp Physical map
 Physical map 
     Restriction map
 Restriction map Prediction of protein coding region (GeneMark analysis).
 Prediction of protein coding region (GeneMark analysis).
    | N-terminal truncation | Coding interruption | |
|---|---|---|
| cloned DNA seq | No warning | No warning | 
 Integrity of 3' end
 Integrity of 3' end
    | Length of 3'UTR | 1439 bp | 
|---|---|
| Genome contig ID | gi89161218r_53880877 | 
| PolyA signal sequence (None) | +----*----+----*----+----*----+---- | 
| Flanking genome sequence (100000 - 99951) | ----+----*----+----*----+----*----+----*----+----* | 
 Length: 1084 aa
 
        Length: 1084 aa Result of homology search against nr database 
        (FASTA output,
	Multiple alignment)
        Result of homology search against nr database 
        (FASTA output,
	Multiple alignment)|  | 
 | 
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
 Result of homology search against HUGE database
        (FASTA output,
	Multiple alignment)
        Result of homology search against HUGE database
        (FASTA output,
	Multiple alignment)The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
 Result of motif / domain search (InterProScan and SOSUI)
	Result of motif / domain search (InterProScan and SOSUI) Result of InterProScan
 Result of InterProScan
| Search method | interpro_ID | From | To | Entry | Definition | 
|---|---|---|---|---|---|
| HMMPfam | IPR001965 | 67 | 116 | PF00628 | Zinc finger | 
| IPR013129 | 294 | 394 | PF02373 | Transcription factor jumonji | |
| HMMSmart | IPR001965 | 67 | 114 | SM00249 | Zinc finger | 
| IPR003347 | 255 | 411 | SM00558 | Transcription factor jumonji/aspartyl beta-hydroxylase | |
| ProfileScan | IPR001965 | 65 | 116 | PS50016 | Zinc finger | 
| IPR003347 | 255 | 411 | PS51184 | Transcription factor jumonji/aspartyl beta-hydroxylase | |
| ScanRegExp | IPR013032 | 68 | 83 | PS01186 | EGF-like region | 
| IPR001965 | 68 | 113 | PS01359 | Zinc finger | 
|  RT-PCR-ELISA | 
 
 Experimental conditions
 Experimental conditions| Primer_f | TTCCCCTGTCCTTCCTTCGTG | 
|---|---|
| Primer_r | GGGTAGTGCCAAATGGAGGTG | 
| PCR conditions | 95 °C  30 sec  55 °C  30 sec  72 °C  60 sec  30 cycles  | 
 Chromosome No. X
 Chromosome No. X Experimental conditions
 Experimental conditions| Panel name | GeneBridge 4 | 
|---|---|
| Primer_f | TTCCCCTGTCCTTCCTTCGTG | 
| Primer_r | GGGTAGTGCCAAATGGAGGTG | 
| PCR product length | 126 bp | 
| PCR conditions | 95 °C  15 sec  66 °C  60 sec  30 cycles | 
 Japan
 || 
Other countries
Japan
 || 
Other countries