KIAA1031

Product ID	ORK07405
Accession No	AB028954
Description	zinc finger CCCH-type containing 7B
Clone name	fh00470
Vector information	The cDNA fragment was inserted at the XhoI-NotI site of the ... The cDNA fragment was inserted at the XhoI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was inserted at the XhoI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5497 bp) Predicted protein sequence (940 aa)
Source	Human fetal brain
Rouge ID	mKIAA1031 by Kazusa Mouse cDNA Project

Length: 5497 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	2674 bp
Genome contig ID	gi89161203f_39951700
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- TTTTGTCCTTCTTAAAATAAAATGAAAGAAACTTG
Flanking genome sequence (134355 - 134404)	----+--------+--------+--------+--------+----* CTTCCCTTAGCCTTTGTTCTAGAAAATAAACTTGTGCACTTTGACCTCTG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	22	f	40051696	40086053	20	99.4	Perfect prediction

Length: 940 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
CAI23515	100.0	zinc finger CCC...	Homo sapiens
BAG37501	99.9	unnamed protein...	Homo sapiens
AAI52559	99.6	Zinc finger CCC...	Homo sapiens
XP_001168979	99.0	zinc finger CCC...	Pan troglodytes
XP_001168953	98.0	zinc finger CCC...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001440	45	78	PF00515	Tetratricopeptide TPR_1
	IPR001440	79	112	PF00515	Tetratricopeptide TPR_1
	IPR000571	443	469	PF00642	Zinc finger
	IPR000571	575	600	PF00642	Zinc finger
	IPR000571	718	744	PF00642	Zinc finger
	IPR000571	850	876	PF00642	Zinc finger
HMMSmart	IPR013026	45	78	SM00028	Tetratricopeptide region
	IPR013026	79	112	SM00028	Tetratricopeptide region
	IPR000571	444	470	SM00356	Zinc finger
	IPR000571	574	600	SM00356	Zinc finger
	IPR000571	719	744	SM00356	Zinc finger
	IPR000571	851	876	SM00356	Zinc finger
ProfileScan	IPR013026	45	78	PS50005	Tetratricopeptide region
ProfileScan	IPR013026	45	112	PS50293	Tetratricopeptide region

Primer_f	GCTGAGGGCAATGATCTGTTC
Primer_r	AGGCCCATGGTGAAGTAGCAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	GCTGAGGGCAATGATCTGTTC
Primer_r	AGGCCCATGGTGAAGTAGCAG
PCR product length	170 bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles