Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK07405 |
---|---|
Accession No | AB028954 |
Description | zinc finger CCCH-type containing 7B |
Clone name | fh00470 |
Vector information | |
cDNA sequence | DNA sequence (5497 bp) Predicted protein sequence (940 aa) |
Source | Human fetal brain |
Rouge ID |
mKIAA1031
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 2674 bp |
---|---|
Genome contig ID | gi89161203f_39951700 |
PolyA signal sequence (AATAAA,-20) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (134355 - 134404) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 22 | f | 40051696 | 40086053 | 20 | 99.4 | Perfect prediction |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR001440 | 45 | 78 | PF00515 | Tetratricopeptide TPR_1 |
IPR001440 | 79 | 112 | PF00515 | Tetratricopeptide TPR_1 | |
IPR000571 | 443 | 469 | PF00642 | Zinc finger | |
IPR000571 | 575 | 600 | PF00642 | Zinc finger | |
IPR000571 | 718 | 744 | PF00642 | Zinc finger | |
IPR000571 | 850 | 876 | PF00642 | Zinc finger | |
HMMSmart | IPR013026 | 45 | 78 | SM00028 | Tetratricopeptide region |
IPR013026 | 79 | 112 | SM00028 | Tetratricopeptide region | |
IPR000571 | 444 | 470 | SM00356 | Zinc finger | |
IPR000571 | 574 | 600 | SM00356 | Zinc finger | |
IPR000571 | 719 | 744 | SM00356 | Zinc finger | |
IPR000571 | 851 | 876 | SM00356 | Zinc finger | |
ProfileScan | IPR013026 | 45 | 78 | PS50005 | Tetratricopeptide region |
IPR013026 | 45 | 112 | PS50293 | Tetratricopeptide region |
RT-PCR-ELISA |
Primer_f | GCTGAGGGCAATGATCTGTTC |
---|---|
Primer_r | AGGCCCATGGTGAAGTAGCAG |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | GeneBridge 4 |
---|---|
Primer_f | GCTGAGGGCAATGATCTGTTC |
Primer_r | AGGCCCATGGTGAAGTAGCAG |
PCR product length | 170 bp |
PCR conditions | 95 °C15 sec66 °C60 sec30 cycles |