KIAA0922

Product ID	ORK05626
Accession No	AB023139
Description	KIAA0922
Clone name	hh02839a
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (2505 bp) Predicted protein sequence (790 aa)
Source	Human adult brain
Rouge ID	mKIAA0922 by Kazusa Mouse cDNA Project

Length: 2505 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	132 bp
Genome contig ID	gi89161207f_154643151
PolyA signal sequence (AATAAA,-16)	+--------+--------+----*----+---- TTTGGCACTTTTATATGAAAATAAATTTTTTAATG
Flanking genome sequence (134161 - 134210)	----+--------+--------+--------+--------+----* AAATCTGGGTGCTCTGTTTTTTTTAACTCTTCATAAATCAGTGGTAAAAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	4	f	154743151	154777310	13	100.0	Perfect prediction

Length: 790 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG53317	100.0	unnamed protein...	Homo sapiens
CAB66866	100.0	hypothetical pr...	Homo sapiens
A2VDJ0	100.0	Transmembrane p...	Homo sapiens
NP_001124479	100.0	hypothetical pr...	Homo sapiens
XP_001499777	85.4	similar to C27F...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D87446	2.2e-07	21.6	KIAA0257

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Primer_f	CGTGTGCAAGGAATACTACCC
Primer_r	ACACATTCCCACAGTAACTCG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-