KIAA0831

Product ID	ORK00648
Accession No	AB020638
Description	autophagy related 14
Clone name	hj04502
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4943 bp) Predicted protein sequence (406 aa)
Flexi ORF Clone	FXC00648
Source	Human adult brain
Rouge ID	mKIAA0831 by Kazusa Mouse cDNA Project

Length: 4943 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	3227 bp
Genome contig ID	gi51511730r_54802863
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- TTTTATTGTATTACTGCAATAAATCTTTTAACAGT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACTTTGCTCATGTGTATGTCTTTTTCAAACTGTTCATTTGCACTGCTGCA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	14	r	54902863	54930775	8	98.9	Terminal No-hit

Length: 406 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_001162169	3.3e-150	100.0	hypothetical pr...	Pan troglodytes
XP_001088634	1.4e-149	99.7	similar to CG11...	Macaca mulatta
XP_001914895	7.2e-146	96.1	similar to CG11...	Equus caballus
XP_583052	9.6e-146	95.8	similar to CG11...	Bos taurus
XP_547826	1.5e-145	96.3	similar to DNA ...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Primer_f	GGGGAAAAACAGTATATCACC
Primer_r	AGTCCTCTAACAGCATGCCAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Chromosome No. 14

Experimental conditions

Panel name	GeneBridge 4
Primer_f	GGGGAAAAACAGTATATCACC
Primer_r	AGTCCTCTAACAGCATGCCAC
PCR product length	97 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles