Order Kazusa clone(s) from : ![]() |
Product ID | ORK01675 |
---|---|
Accession No | AB018343 |
Description | Vpr (HIV-1) binding protein, transcript variant 1 |
Clone name | hg03850s1 |
Vector information | |
cDNA sequence | DNA sequence (5984 bp) Predicted protein sequence (1521 aa) |
HaloTag ORF Clone |
FHC01675
![]() |
Flexi ORF Clone | FXC01675 |
Source | Human adult brain |
Rouge ID |
mKIAA0800
by Kazusa Mouse cDNA Project
|
Note | We replaced hg03850, former representative clones for KIAA0800 with hg03850s1. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 1292 bp |
---|---|
Genome contig ID | gi89161205r_51308382 |
PolyA signal sequence (AATAAA,-21) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (99956 - 99907) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 3 | r | 51408338 | 51509041 | 25 | 100.0 | Internal No-hit |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR013720 | 862 | 888 | PF08513 | LisH dimerisation motif |
HMMSmart | IPR006594 | 860 | 892 | SM00667 | LisH dimerisation motif |
ProfileScan | IPR006594 | 860 | 892 | PS50896 | LisH dimerisation motif |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 601 | PAEVFLKLSCVQLLLQLISIACN | 623 | SECONDARY | 23 | 2 | 632 | DTVRFALDVLAILTVVPKIQLQL | 654 | PRIMARY | 23 |
---|
![]() |
Primer_f | AACAACATACCAAGGCAGCTC |
---|---|
Primer_r | AGTCAGTTGGGTACAGCAGGA |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | AACAACATACCAAGGCAGCTC |
Primer_r | AGTCAGTTGGGTACAGCAGGA |
PCR product length | 160 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |