Order Kazusa clone(s) from : ![]() |
Product ID | ORK06730 |
---|---|
Accession No | AB018333 |
Description | SAM and SH3 domain containing 1 |
Clone name | hk05609 |
Vector information | |
cDNA sequence | DNA sequence (4469 bp) Predicted protein sequence (1319 aa) |
Source | Human adult brain |
Rouge ID |
mKIAA0790
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR011511 | 630 | 685 | PF07653 | Variant SH3 |
IPR011510 | 707 | 769 | PF07647 | Sterile alpha motif homology 2 | |
IPR011510 | 1246 | 1313 | PF07647 | Sterile alpha motif homology 2 | |
HMMSmart | IPR001452 | 629 | 686 | SM00326 | Src homology-3 |
IPR001660 | 702 | 769 | SM00454 | Sterile alpha motif SAM | |
IPR001660 | 1246 | 1313 | SM00454 | Sterile alpha motif SAM | |
ProfileScan | IPR001660 | 705 | 769 | PS50105 | Sterile alpha motif SAM |
IPR001660 | 1249 | 1313 | PS50105 | Sterile alpha motif SAM |
![]() |
Primer_f | ATTAGTGCGGTTCTCTTTGAC |
---|---|
Primer_r | AGACTGGAGATAGAGCATTCG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | ATTAGTGCGGTTCTCTTTGAC |
Primer_r | AGACTGGAGATAGAGCATTCG |
PCR product length | 110 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |