Order Kazusa clone(s) from : ![]() |
Product ID | ORK01992 |
---|---|
Accession No | AB018277 |
Description | BAI1-associated protein 3, transcript variant 1 |
Clone name | hk03764s2 |
Vector information | |
cDNA sequence | DNA sequence (4530 bp) Predicted protein sequence (1190 aa) |
HaloTag ORF Clone |
FHC01992
![]() |
Flexi ORF Clone | FXC01992 |
Source | Human adult brain |
Rouge ID |
mKIAA0734
by Kazusa Mouse cDNA Project
|
Note | We replaced hk03764s1 and hk03764, former representative clones for KIAA0734 with hk03764s2. (2008/8/27,2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 956 bp |
---|---|
Genome contig ID | gi51511732f_1224654 |
PolyA signal sequence (AATATA,-22) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (114788 - 114837) |
----+----*----+----*----+----*----+----*----+----* |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR000008 | 1045 | 1057 | PR00360 | C2 calcium-dependent membrane targeting |
IPR000008 | 1076 | 1089 | PR00360 | C2 calcium-dependent membrane targeting | |
HMMPfam | IPR000008 | 200 | 309 | PF00168 | C2 calcium-dependent membrane targeting |
IPR010439 | 564 | 645 | PF06292 | Protein of unknown function DUF1041 | |
IPR000008 | 1030 | 1122 | PF00168 | C2 calcium-dependent membrane targeting | |
HMMSmart | IPR000008 | 199 | 368 | SM00239 | C2 calcium-dependent membrane targeting |
IPR000008 | 1029 | 1137 | SM00239 | C2 calcium-dependent membrane targeting | |
ProfileScan | IPR000008 | 200 | 317 | PS50004 | C2 calcium-dependent membrane targeting |
IPR014770 | 666 | 787 | PS51258 | Munc13 homology 1 | |
IPR014772 | 891 | 999 | PS51259 | Munc13 homology 2 | |
IPR000008 | 1029 | 1122 | PS50004 | C2 calcium-dependent membrane targeting |
Primer_f | TACAGCCGCTTCCATTTCACG |
---|---|
Primer_r | GCGGGTGGAACATTTGTGCAG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | CTGAGCGTCCGTTGCCATTAC |
Primer_r | GACCAGTGGAAAGAGATGCGG |
PCR product length | 150 (0.3k) bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |