KIAA0630

Product ID	ORK05422
Accession No	AB014530
Description	homeodomain interacting protein kinase 1
Clone name	hh01735
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5761 bp) Predicted protein sequence (490 aa)
Source	Human adult brain
Rouge ID	mKIAA0630 by Kazusa Mouse cDNA Project

Length: 5761 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	4287 bp
Genome contig ID	gi89161185f_114207585
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- ATTGCAATGCATCAATAAAATGGGTAAATTTTCTG
Flanking genome sequence (114361 - 114410)	----+--------+--------+--------+--------+----* ACTTATGTGGCTGTTTTTGACTTCTGTTATAGGATATAAAGGGGATCAAT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	f	114307585	114321944	7	99.2	Perfect prediction

Length: 490 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
CAI22795	1.6e-160	99.8	homeodomain int...	Homo sapiens
AAH28408	1.7e-160	99.8	Homeodomain int...	Homo sapiens
Q86Z02	2.2e-160	99.8	Homeodomain-int...	Homo sapiens
BAG63945	2.3e-160	99.8	unnamed protein...	Homo sapiens
AAH36057	3e-160	99.6	Homeodomain int...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Primer_f	CCACAGCAATGATTCCAGAGG
Primer_r	TGGTTAGTCAGCAAGGATGGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Chromosome No. 1

Experimental conditions

Panel name	GeneBridge 4
Primer_f	CCACAGCAATGATTCCAGAGG
Primer_r	TGGTTAGTCAGCAAGGATGGC
PCR product length	121 (1.0k) bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles