Order Kazusa clone(s) from : ![]() |
Product ID | ORK04696 |
---|---|
Accession No | AB007965 |
Description | Cysteine/histidine-rich protein 1 (Fragment). |
Clone name | hg00144 |
Vector information | |
cDNA sequence | DNA sequence (6151 bp) Predicted protein sequence (218 aa) |
Source | Human adult brain |
Rouge ID |
mKIAA0496
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | Warning |
Length of 3'UTR | 546 bp |
---|---|
Genome contig ID | gi51511724r_145547318 |
PolyA signal sequence (AATAAA,-22) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 8 | r | 145647318 | 145654119 | 2 | 99.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
ProfileScan | IPR001293 | 42 | 100 | PS50145 | Zinc finger |
Primer_f | |
---|---|
Primer_r | |
PCR conditions | °C![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | ATGCAGTCCAGGTGTGAAAGG |
Primer_r | TAAAGGGGAGCTAGATGGGCG |
PCR product length | 141 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |