KIAA0483

Product ID	ORK04999
Accession No	AB007952
Description	F-box protein 28
Clone name	hj00879
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5201 bp) Predicted protein sequence (299 aa)
Source	Human adult brain
Rouge ID	mKIAA0483 by Kazusa Mouse cDNA Project

Length: 5201 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	4300 bp
Genome contig ID	gi89161185f_222268661
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- CAACAGGGTACGTAAATAAATGTGTTGTTACCAGT
Flanking genome sequence (147712 - 147761)	----+--------+--------+--------+--------+----* GCTACTTGTTTTCTTTGTATTTCATGCACAAAAGAATATGGAGCTCTATT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	f	222368661	222416371	5	99.1	Perfect prediction

Length: 299 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q9NVF7	7.7e-100	100.0	F-box only prot...	Homo sapiens
XP_001097187	7.7e-100	100.0	similar to F-bo...	Macaca mulatta
XP_001915239	3.2e-99	99.3	similar to F-bo...	Equus caballus
Q2NL16	3.2e-99	99.3	F-box only prot...	Bos taurus
EDL94872	6.2e-99	99.0	F-box protein 2...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Primer_f
Primer_r
PCR conditions	°C sec °C sec cycles

Chromosome No. 1

Experimental conditions

Panel name	GeneBridge 4
Primer_f	TTACGTACCCTGTTGTGTGAC
Primer_r	CCTTTATTGTGGTACCATGTC
PCR product length	144 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles