KIAA0394

Product ID	ORK00064
Accession No	AB007854
Description	growth arrest-specific 7, transcript variant d
Clone name	hf00236
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (7979 bp) Predicted protein sequence (417 aa)
HaloTag ORF Clone	FHC00064
Flexi ORF Clone	FXC00064
Source	Human adult brain
Rouge ID	mKIAA0394 by Kazusa Mouse cDNA Project

Length: 7979 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	6619 bp
Genome contig ID	gi51511734r_9654651
PolyA signal sequence (TATAAA,-22)	+--------+--------+----*----+---- TGTCCTGCATTATTATAAAGAGTTTTCAGGAAGTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAATCCCATCTCGTTTTTTTTTTCTTCTGCTCTGTGTGTATCCTCGAGAT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	17	r	9754651	9870303	14	100.0	Perfect prediction

Length: 417 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAH11897	4.1e-136	99.8	unnamed protein...	Homo sapiens
O60861	5e-136	99.8	Growth arrest-s...	Homo sapiens
AAH06454	5.1e-136	100.0	Growth arrest-s...	Homo sapiens
BAD92267	7.3e-136	99.8	growth arrest-s...	Homo sapiens
BAC21639	4.8e-135	99.0	hypothetical pr...	Macaca fascicularis

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB006628	1.7e-05	26.6	KIAA0290

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001202	20	49	PF00397	WW/Rsp5/WWP
HMMPfam	IPR001060	143	237	PF00611	Cdc15/Fes/CIP4
HMMSmart	IPR001202	19	51	SM00456	WW/Rsp5/WWP
HMMSmart	IPR001060	151	237	SM00055	Cdc15/Fes/CIP4
ProfileScan	IPR001202	18	51	PS50020	WW/Rsp5/WWP
ProfileScan	IPR001060	137	229	PS50133	Cdc15/Fes/CIP4
ScanRegExp	IPR001202	24	49	PS01159	WW/Rsp5/WWP

Primer_f	GAGTGGGAGACCTTAAAACCG
Primer_r	CGCTACTCGCTGGTGTTAATG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	GAGTGGGAGACCTTAAAACCG
Primer_r	CGCTACTCGCTGGTGTTAATG
PCR product length	80 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles